EST 1525943 is a singleton


Sequence

>1525943 (1 EST) Length=194 GTTTATTGGATGTTATGGAACACTTGTACAAACTCCAAAATTATAGTACCTACCTATCTTATCTTTGTGCATTTCTCCTA GTACCAGAAGCTTTGTTTTCTCGAAAAACACTCAGTCGTCTTAGTCGGGTTACGCCGTACATGCAACCGCCCTACTTTTC AAAATATCGTCGTGATTTAGAAGCAGCCAATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1525943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259432873400AA804152SMTBADA000930SKSchistosoma Lambda Zap II


Date: 23:0:33 on Fri 24 Nov 117.