EST 1525946 is a singleton


Sequence

>1525946 (1 EST) Length=165 TTATATAATGTGATAAAAACCAAAGATATTCCAAATGTTCTCCACTTGTTTTCTTCGTTTTTATTGTTTCTCTCTCTCAT ATTCATTTCTACTAGAAGGGGATTTCCAAAAAAGATTTAGACAAAGTTTTTTTGTTTTTTGTTTTTGTTTTTGTTTTTAT TTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1525946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259462873403AA804155SMTBADA000940SKSchistosoma Lambda Zap II


Date: 18:41:25 on Sat 18 Nov 117.