EST 1525948 is a singleton


Sequence

>1525948 (1 EST) Length=185 GACGGCACACCGAATGTCCCATCGACTACTTCAAACGTCGATCTTCTAAGTGATTTCCTCGGGAATTCTGGGCAGTTCTG AATACCATTAAAATACGATATGGATTTATTCTATTTCACACTTCTTATTCATTCCTCTTTAGTGCTCGAAATAGGAAGCA TCCTAACAATATTTAAGTAAAAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1525948: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259482873405AA804157SMTBADA000946SKSchistosoma Lambda Zap II


Date: 0:50:53 on Fri 24 Nov 117.