EST 1525950 is a singleton


Sequence

>1525950 (1 EST) Length=210 TGCAATCATGGGTATTTACTAGGAGCGNANNACNNNNNNCTCACTGCCAATACTATTACGCAATCAATATGAAAATCGGT TTTCAATACTTGGCAAAAGTACATAGTAACGTCAACTCATAACTTGAACTCAATATTAGCATAACTTAATGTTTGCAGTT AATCTGATATAACTTCAACATTTCGATAAATATAATCAACAACATAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1525950: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259502873407AA804144SMTBADA000959SKSchistosoma Lambda Zap II


Date: 22:38:4 on Tue 21 Nov 117.