EST 1525951 is a singleton


Sequence

>1525951 (1 EST) Length=215 CCTTTCTCAAGCCAAGTGCAATCAAAAGACATGACGGACAGAGTCCGATTAACTGTCAAAACAAAACGCAACAACGAGTT AATAGTTTACAATCTCAATTAATCATTATCGAAGTAGCAGCTATTGTCATCTACAACTAACACTAGTCGTCGAAACTCGT TCTATAACCTTTTTATTATTACTTAATCCCAAACTCTTGTACGCCATACTGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1525951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259512873408AA804145SMTBADA000960SKSchistosoma Lambda Zap II


Date: 12:31:33 on Fri 17 Nov 117.