EST 1525952 is a singleton


Sequence

>1525952 (1 EST) Length=211 GAGATTTACGCACTGCGGATTTATACACGTGTACTTTTTCCATAGTGTGGTTATAAAAAAAGCATAAATAAATCTAAAAT AGTTAGAAACGACCGAAACAAATTGTTTCAGGATATGTGTGTATTTTTTACAACATAACATATACAAATATAGAAAAAGA TCATGTAGACTTCAGAACGTTGCACATTTCCTATAGAAGAACTATATGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1525952: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259522873409AA804146SMTBADA000976SKSchistosoma Lambda Zap II


Date: 6:16:20 on Wed 22 Nov 117.