EST 1525954 is a singleton


Sequence

>1525954 (1 EST) Length=158 GGTATGAGAAAAATGTACCGATAATACTATGTTTAACCATATTCATCAAAGTCTGGGTTTAATGAGCGTTCCCTGTTTTG TTTTTTCTGATCGTAAGATCATTATATTTGTCAAGCAAGCAGTGTTTTATATAAGTAAAGTCTTCTTTACTTTTGCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1525954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259542873411AA804148SMTBADA000981SKSchistosoma Lambda Zap II


Date: 0:30:46 on Fri 24 Nov 117.