EST 1541758 is a singleton


Sequence

>1541758 (1 EST) Length=195 GTATTTGCNTCTTTTAAGTATTAATCGACCAGAAATGATTTACATTATAATGGGTTGTNTCTNTTCAATCATATCAGGAT TATTACAATTAGCTTTTTCACTTCTTTACTCTGAAGTTTATCAGGTATTTNATTTACGCAAAACTCCTGATGAAATGACC AAAAAAATTAATATGGTTTCTNGTATTATGGCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1541758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417582889770AA819927MF5MA174.AM3S. mansoni female adult Lambda Zap


Date: 19:40:41 on Fri 17 Nov 117.