EST 1541763 is a singleton


Sequence

>1541763 (1 EST) Length=239 GTATTATTTAGTGTTCTAGAAAATTGTCGAATTCTTCACTTAGTTCAAAATAGCTAAAAATTCAATTTGGTCGAAACGTT GAGTTTATCCTCATATTCTAATCTATGGAGGGAGGAGGAAAACTAAACAGGGAACCATCAGACAACTCTCTGGCTTCATT CTGTCAAAATGATATTACGGAATCCCTTATAACTCAGCCGATCCCTATTAATATTCGGATTGCTCAAGATATACAGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1541763: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417632889775AA819932MF5MA177.AM3S. mansoni female adult Lambda Zap


Date: 19:19:39 on Sun 19 Nov 117.