EST 1541767 is a singleton


Sequence

>1541767 (1 EST) Length=328 ACGATAATGATCAAAATGAACCTAGAGAAGATACTGTTGGTCCTTTACCATCTGANATGATGCAGTTTCAGGAAGATGTC AGCGAAAATGGTGATTCTGTAGCAATCCCTAAAAAGAAACGTAAAGTCCTTAAAGATGAAGCAATTTACCTACGTAATAT TCCAATAGCTCAATACTACGAAATAAGTTATATGCATAGAAATGTGATAACACACGTTGCCTACTCACAAACTCACTATT TGATGACATGTAGCAATGATGGTCATCTTAACTTTTGGCGGAAAGCTGATGGTATTGGACTAGAGTTTATCAAACACTAC CGAGCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1541767: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417672889779AA819936MF5MA183.AM3S. mansoni female adult Lambda Zap


Date: 6:21:12 on Fri 24 Nov 117.