EST 1541769 is a singleton


Sequence

>1541769 (1 EST) Length=293 GTTTAAATGGAAAAGGAGGATCNTTCATGGAAAGCTGCTATACTTTCATCACTTTTTGAACGCGATATTATTGAGAAGTC GTTTTTTACTGATATTTTTACACAATACAACTCGAATAAGGATCAAGTGCTATACCTTAAAGGGGAAAACACTCGACTTG TTCGTGAATTAACATCATGTCAACAAGAGAAATCCGCAATACAACTAGAGCTTGAAAAGATAAAGTCTGTTAAATCTTAT GACTATGAGCAAAAGGTGTTTCATTTGCCAAGAAGAGGTTACCGAATTGCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1541769: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417692889781AA819938MF5MA185.AM3S. mansoni female adult Lambda Zap


Date: 5:59:39 on Sun 19 Nov 117.