EST 1541770 is a singleton


Sequence

>1541770 (1 EST) Length=269 ATAATTCCAAAATGAAATATTAATATTATACTTATATAATCTTTAAAACAAAATATAATTAAATAAAATCGACTGATTGA NTAGAGACCAGATAAGTGAAAATTTATATTTAGCGTTATTGACCGGAAAAAATTACGTAACAAATATTTATAGATGAAGT CGCTGTGATAAGGCAGAGTTGATAACTGAGTCTTCAAATTCATAAATTTGGTTTCAGTCTCTCTTTATGGTAATCGCTTC AGCAAAACATTATTAAATTCAATGTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1541770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417702889782AA819939MF5MA186.AM3S. mansoni female adult Lambda Zap


Date: 5:2:2 on Sat 18 Nov 117.