EST 1541771 is a singleton


Sequence

>1541771 (1 EST) Length=348 CCTTAACTTTTGTCAAATTTAATAATCATCCAGCTGAACAATTCCTTGTTGTGGCTCTTGTCAAGGATCTTATCCTCAAT CCCCGTTCATGTTCTGGTGGTTGTTTAAAGACATATCGAATTTGGAACAATGGAGAACGTCTCGAATTCCTTCACGAAAC ACCAGTTGATGATTTTCCAGCAGCTCTATGTGCTTTTCAAGGTCGTCTTCTTGTGGGTGTCGGAAATCGTTTACGAATAT ATGATCTAGGGAAAAAAAAGTTGTTGAAAAAATGTGAAAACAAGCACATTCCTACTCTAATCAATGGTATTTATTCTGTA GGCAGTCGGATAATTGTGACAGATGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1541771: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417712889783AA819940MF5MA187.AM3S. mansoni female adult Lambda Zap


Date: 13:29:26 on Wed 22 Nov 117.