EST 1541772 is a singleton


Sequence

>1541772 (1 EST) Length=340 CGCAGATGGACATGCAGTTCAAATTATAAATGTTGAAGAATGTATGANGAAAACATCATTCACTCTAGATGAGGAGTCTT TGTNTTCAATTCTTTTAAGACCGGATGTGCGTGACAAAAAAGTTGTTGTGGTCTCAGTTGCTGGTGCGTTTCGTCAAGGA AAATCGTTTTTACTGGATTTNNTCCTACGTTATTTGTTGTCCAGTGACCGTACTAACTGGCTAGGAGACCCAGAAACACC TTTGAAGGGCTTTCCTTGGCGAGGTGGTTCGGAGAGAGACACTGTTGGAATATTGTTATGGAGCGAACCATTCTTTATGA CTCTACCATCTGGAGAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1541772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15417722889784AA819941MF5MA188.AM3S. mansoni female adult Lambda Zap


Date: 12:46:47 on Tue 21 Nov 117.