EST 1546946 is a singleton


Sequence

>1546946 (1 EST) Length=211 CACGAGGTTTCATCTCCTCTTGATTTTACCCCTATCTTCAATCCTTTTCGACTAGTTCCATCCCAATGTATCTGTTGTAT ACTTCCTGGAATATTGAAGAGTTGAACTAACTTATTACTTTGAGTACTTTAATCCCATTTCGACCCAGTCATCTGAAGAG CAAGATCCAAAAGTTGTGGGTCACTGAGATATATCTAATATTATTGCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546946: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469462897567AA825089SMTBCEA000006SKSchistosoma Lambda Zap II cercariae


Date: 2:44:45 on Mon 20 Nov 117.