EST 1546951 is a singleton


Sequence

>1546951 (1 EST) Length=162 ACAATTTCTTCACTTCGACTTTGAAAAATGTTAATCACCGAAGGAGTATGTTTTATTACTCAAAGAACATTGCTACAAAT TCACCAAAATATCCTCAGAGAAGAGAGAGAAATTTGATGGAAAAGTATTTTCTTTAAGGAATGCGATTGCTGTGCCATTT GG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469512897572AA825094SMTBCEA000021SKSchistosoma Lambda Zap II cercariae


Date: 1:41:31 on Sat 18 Nov 117.