EST 1546952 is a singleton


Sequence

>1546952 (1 EST) Length=190 CCCACGAGGAGAATTAGTAATTCAACGGACTTAATCCTCAGACCATTAGGAACAAATGCTACAGCAGAACAAGCCATATG TCAATCACAAGTACAGTCAGTTCCAAATACGAAAAGCTTTTGTAGACTTACCCGGACTTGTTGGCAGATCAAAAGCCTCC AGATTTAAGCTCGAAAAACATTCATTCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546952: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469522897573AA825095SMTBCEA000022SKSchistosoma Lambda Zap II cercariae


Date: 18:44:59 on Sat 18 Nov 117.