EST 1546954 is a singleton


Sequence

>1546954 (1 EST) Length=180 GCACGAGCAGTTTTATTTACAATGTCTGTTGTTGCAGTTACTATTTTTTTATTTTGGTCTACAAGAAACTTTATAAAATT TGAAAATTAACAGGAATGATTTTATTTATTATTTAGAATGTTTAATATGTGACATTTTAGGATATTGATGTTCTCATTTA ATCATTTTTTGAGATCTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1546954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469542897575AA825097SMTBCEA000025SKSchistosoma Lambda Zap II cercariae


Date: 11:43:26 on Fri 24 Nov 117.