EST 1546955 is a singleton


Sequence

>1546955 (1 EST) Length=110 CATTTCTTTGACGAGCGCACACTGACCTAGAAGATATCAGTGAAGAGTCGTTTAATGAAGCTTAGGGGAACGAGAATAGT ATGAGCTGAGTTATTGGAACAAGTGGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546955: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469552897576AA825098SMTBSOA000001SKSchistosoma Lambda Zap II


Date: 0:20:40 on Thu 23 Nov 117.