EST 1546956 is a singleton


Sequence

>1546956 (1 EST) Length=96 GCTTAGATGTCAGATTGAGCACGATGATCGATTGACCGTGAGATCGACGAGATGCGCAGATCGAGATCTGCATACAGATG ATGACCATAGTGTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469562897577AA825099SMTBSOA000002SKSchistosoma Lambda Zap II


Date: 14:30:42 on Sat 18 Nov 117.