EST 1546957 is a singleton


Sequence

>1546957 (1 EST) Length=105 GTCGACCTGCATAGGATGATCCGGTGGATATATCATCGTTATCTACAATTAGCATATCATCTATCAGTGAGTGCTATTAC AACTTACTCGGATATGCTAAGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469572897578AA825100SMTBSOA000003SKSchistosoma Lambda Zap II


Date: 0:20:7 on Fri 24 Nov 117.