EST 1546958 is a singleton


Sequence

>1546958 (1 EST) Length=126 GATCCGTCTCGGGTAGCCCCACATGTGCTGCCACTACTCAAGATGTAGTTCGATATTACAATAATGTCTAGCATGGTCCG GATCTGTATATAATCTAACAGTCGATCGAGCTGATGAAAACCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546958: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469582897579AA825101SMTBSOA000004SKSchistosoma Lambda Zap II


Date: 8:15:48 on Thu 23 Nov 117.