EST 1546961 is a singleton


Sequence

>1546961 (1 EST) Length=174 CCACAGGACGTCGCAGCAAGAGCTCACGAAGAGCTTCATCAGCAGTCGATCAGTCGATCAGTCGTCGTCGCGTCTACATC AATTTCGCCCTATTAGATGTGATACTGTATATTACAATTTCACTAGTGCCGTTCGTTTTATCAAGGATCTGTGTACTAGT GAAACCTGGTCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1546961: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469612897582AA825104SMTBSOA000007SKSchistosoma Lambda Zap II


Date: 19:16:45 on Thu 23 Nov 117.