EST 1546963 is a singleton


Sequence

>1546963 (1 EST) Length=135 GATGAGGACGTGATCGTGATGATGTGGTTACTACATCGGTATCCCAATTATCGTCCCTATAGTGAGTCGTATTACAATTC ACTGGCCGTGTTTTACAACGTCGTGACTGGGAAACCTGGCGTTACCAATTAATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1546963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469632897584AA825106SMTBSOA000009SKSchistosoma Lambda Zap II


Date: 21:16:7 on Fri 24 Nov 117.