EST 1546964 is a singleton


Sequence

>1546964 (1 EST) Length=107 GGGGCCGTATCCAATCTGACCCATAGTGTAGCGATTTCAAACTTACGGCTCAGTGTTTCAAACGCTGGCTAGGGTAAACC TGGTCGATCCAACAATCAGCCGAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546964: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469642897585AA825107SMTBSOA000010SKSchistosoma Lambda Zap II


Date: 16:4:55 on Fri 17 Nov 117.