EST 1546965 is a singleton


Sequence

>1546965 (1 EST) Length=114 TAAATTCGTCCCTATACGTTATGATCGATCCGCTATTCTACAACTTCACCTCGGTCCGTCCGCTTTTACCAACCGATCGC GTACTAATGGGAAAACTCAATGGAGATTACAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1546965: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469652897586AA825108SMTBSOA000011SKSchistosoma Lambda Zap II


Date: 15:1:47 on Wed 22 Nov 117.