EST 1557700 is a singleton


Sequence

>1557700 (1 EST) Length=379 TCAATCTTTACTCAAAACAATAACAACAAAGCAGTGGCTGTAATTCACGACAATGTCTTATTTAAGGTCGGGGGTTTCTG CTAACGCCGTGCCGTTGTCCAATTGACTTTGGCGGTGGTCGTTTAAGAAATTGTTAATTCCATTTCATTACGATTGTCCC ACACGGGCTTCCGCCGCTGCAATCAAAGGCAGATTTGCTCACAATTTCCTCCCGNNGNGAAATCCGCCCGAATCCCCCCC CTCAAAAAAGGTGCCCCAAATCCCTTTGGAGAGTCGGTTTACCTGTGACCAACGTTGGCGGCACCTCTAGTTTNCNTTAC AGACATGGTGCATCGCCCCTGTATACTCAACATTTGACTCGTGTGTCTCTAAGCAAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1557700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15577002909888AA835602TENU0060T.cruzi epimastigote normalized cDNA Library


Date: 17:13:17 on Wed 22 Nov 117.