EST 1557703 is a singleton


Sequence

>1557703 (1 EST) Length=283 TCTTCGCTCATCCCTGTCGTTATCGTGCGACTCAAACGCTCCACCCATACACGTTCCTTCGGTTTCTTTTTTTTTTTTTT TTCCCGTTCTGTAATTTCATGCATCGCCCTGCTTTGACGCAAGTTGTACAAGGCATAACCATAAGAAATGGTTAAATCCG CACACAGAAATGCAAAAAAAAAAAAAAACTGAAAAACTGAAAAACTGAAAAAACGCGTGGTGATTGAAGGAGTGTACAGA GCCAGAGAAGGTGGGTTAAAGACGAATCTTTTTTAGTTCTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1557703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15577032909891AA835605TENU0064T.cruzi epimastigote normalized cDNA Library


Date: 6:45:29 on Tue 21 Nov 117.