EST 1557710 is a singleton


Sequence

>1557710 (1 EST) Length=315 TCATTCATTCATTCATTCAACAACAAAAACAACAAGCAGAAAGAATGAAAGAAGCACAGACGCAAAATGAATATTGCTCT CTATTTCCAGATGNGACCCGCAACTTCTTTCCTCCTGTCCTGTCCTGTCANTTCGCNCTTTGCCATCCAACGGAGCAACG CNTTANTCATCCGCCCATACNAATCCTCCNTTCTTGCCTCANTTTTTCTANTTCTCATGACTCTNTCTATTTTCAAATCA NTCAGTCTTCTGATGCGACAAACCGTACGTCAACATCCGCGTCTTTTCGCAACCGACTTATAAGCGGCTCAGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1557710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15577102909898AA835612TENU0071T.cruzi epimastigote normalized cDNA Library


Date: 19:36:56 on Mon 20 Nov 117.