EST 1557712 is a singleton


Sequence

>1557712 (1 EST) Length=370 TAGAAGGTCGGCGGCGTCAATGGACAGTGTTGTTACCGGTTAGACTGGGAATTGGCGAATCTGGGTCCAATATATATATA TATATATATATTTCCCGTTTCTGTTACCATTCACCCACGCATTCCTTACTCTTCTTCTTTGCAAAAATAAAAATAAAAAA AAAATATATTTGCCGCCTTTTTCCCTCCTCGTGGCCACCGGTGTGCACAATCAGATATTTATATAAAGCCCATTTGTCTT TGGCCTACGCAGACACGCGCCTCCTCTACAGNAAATATGTCCGTTCCCCCTCCGTTAATTACAAGCGCTCGCCCTGATCC TCTCGTTCTTACCGGTTTCCCTTTTTTTTTTANTCTTTTGCCTGTATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1557712: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15577122909900AA835614TENU0061T.cruzi epimastigote normalized cDNA Library


Date: 2:47:36 on Fri 24 Nov 117.