EST 1589995 is a singleton


Sequence

>1589995 (1 EST) Length=150 GTTGGCCCTGGATTAGATCGCCAGAATCTGTCAGTCCTCACTAATATGCATGCTAGGTCGCGTATTCGTATCTATATATC CAACGTGTGGCCTCGATCGTGTGTGTTACAACGTCGGTCGATCTACGGTCTAACAATCTCAATGCGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1589995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15899952956619AA864140SMTBSOA000013SKSchistosoma Lambda Zap II


Date: 21:58:16 on Fri 17 Nov 117.