EST 1589996 is a singleton


Sequence

>1589996 (1 EST) Length=99 CCGAATACCTTCGCCCTTGATGGATACGTTTCATTACCTAGGCCGATCGTTTCACGTCGTGCTGGGAAACCTGGCGATTC CCCTTATCGCCTTGACTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1589996: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15899962956620AA864141SMTBSOA000015SKSchistosoma Lambda Zap II


Date: 17:3:59 on Fri 24 Nov 117.