EST 1589997 is a singleton


Sequence

>1589997 (1 EST) Length=124 GGACCAGCAGGACCTCAGCACGCGACTGACTGCGACGACGACCCGTACCAATTCGACCCCTATAGCGTAGTCGTATTACA ATTCACTGGTTCCGTCGTTACAAGCTCGAGTACTGGTTTTCGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1589997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15899972956621AA864142SMTBSOA000016SKSchistosoma Lambda Zap II


Date: 4:14:56 on Mon 20 Nov 117.