EST 1589998 is a singleton


Sequence

>1589998 (1 EST) Length=120 CCCTAGCACCGACCAGCATACGACGATCGATGGTACCTGGATGAAATCGTCTAGGCCATTGCAATCCTAATGGTCAGTGC TATTACAATTCACTGGACGCTAGCTTTACAAGCTCGGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1589998: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15899982956622AA864143SMTBSOA000017SKSchistosoma Lambda Zap II


Date: 0:53:6 on Wed 22 Nov 117.