EST 1589999 is a singleton


Sequence

>1589999 (1 EST) Length=129 CCCGTGACCCGAGATTCGTCCCGTATGAGTGCGTATTGACGAGATTGACCTGAGATACGCTAGACTTTGTAGCAGAGACT GCAATGACTGGGAAAAGACTCTGGAGCGTTACGCGAACTTAAATGCGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1589999: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15899992956623AA864144SMTBSOA000018SKSchistosoma Lambda Zap II


Date: 6:53:22 on Sat 25 Nov 117.