EST 1590000 is a singleton


Sequence

>1590000 (1 EST) Length=118 GTCACCAATTCCTCACGACTATATGGATCGTGATTCAAATTCCATCTCGACGAAATCGAAGTTTTCCACAGACTGCTAGG CATGGGAAACACTAGTCCGAGATGTCCACAATTAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590000: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900002956624AA864145SMTBSOA000019SKSchistosoma Lambda Zap II


Date: 13:18:8 on Wed 22 Nov 117.