EST 1590003 is a singleton


Sequence

>1590003 (1 EST) Length=117 TATAGGATCGAGTTACTGTGATTGACATTTCAACTGGATCTCGTCTCGTTGGATTAGCTAACGTCGATGGACTGGGAAAC TACTGGCGTTAGCCAATTATCGCTGATCATGCCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590003: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900032956627AA864148SMTBSOA000025SKSchistosoma Lambda Zap II


Date: 10:37:35 on Tue 21 Nov 117.