EST 1590006 is a singleton


Sequence

>1590006 (1 EST) Length=168 TGGGTTAAGGATATCACTCAGCATAATGTTAAGTGACCGGCAGCAAAATGTTGCAGCACTGACCCTTTTGGGAACCGCAA TGGGTTGAATTAGCGGAACTGTCGTGTATGGGGACTACTGCCTTGATTCCGATTATCGCTTCTCTCGCTATGCTACTGAG AAGGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1590006: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900062956630AA864151SMTBSOA000030SKSchistosoma Lambda Zap II


Date: 4:19:20 on Fri 24 Nov 117.