EST 1590007 is a singleton


Sequence

>1590007 (1 EST) Length=120 AAAAAAGTATCACTCTCTTTTTGTGAACCACACTGATTGAACAAACCTGACCCTTTTAGAGAGCCGTGTTGTTGAGCAGA CTGCTGTGTTGCGAGTCTCTCAGCCTTGTCCTTCTCGGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590007: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900072956631AA864152SMTBSOA000034SKSchistosoma Lambda Zap II


Date: 1:36:43 on Sat 18 Nov 117.