EST 1590008 is a singleton


Sequence

>1590008 (1 EST) Length=136 GGTCTCAAGGGAATCGGAATCATCAACAGTCAAAGTAAGGTATCTCTGGTCAGTCAAAAGTGCTATGCTACGTACCCGGG TACCGCAAGGGGAAATCGGGATACTCGGGAGGGGACATCGGCGGGTACGAACGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900082956632AA864153SMTBSOA000036SKSchistosoma Lambda Zap II


Date: 13:58:34 on Mon 20 Nov 117.