EST 1590009 is a singleton


Sequence

>1590009 (1 EST) Length=153 CCATGTTAAGGGCGGATAGTCAGCTCGAGGCATAATGTTAAGTAGGCCGCAGCGAAAAGTGTTCGACGGCTACCCTTTTG AGCCGCAATGGTTAATTAGCACGTCTTAACTATCTACACATTATCCTTCTCTACTATACTACTAAACTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1590009: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900092956633AA864154SMTBSOA000039SKSchistosoma Lambda Zap II


Date: 17:47:59 on Mon 20 Nov 117.