EST 1590014 is a singleton


Sequence

>1590014 (1 EST) Length=100 CCCCGGCCCAATTTCCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGCTTTTTACCACGTTGCCCTGGGAAAAAA TTTCCGCCCATCAACTTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1590014: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900142956638AA864159SMTBSOA000059SKSchistosoma Lambda Zap II


Date: 10:12:39 on Wed 22 Nov 117.