EST 1590016 is a singleton


Sequence

>1590016 (1 EST) Length=159 GAGCTCGGGCTCGCTGCCGCGTCGCTGTCCGAATTCGCCCACTCGCTGCCGCGGTCGGCTCCCGACACCCTTTTTTACTT TCCGCTGTATCCCAATTCCCTCTATAGTCTAGATCCAGCCTATTACAATTCACTGGATCATCGTCGATTTTTACATCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590016: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900162956640AA864161SMTBSOA000062SKSchistosoma Lambda Zap II


Date: 17:9:33 on Fri 24 Nov 117.