EST 1590018 is a singleton


Sequence

>1590018 (1 EST) Length=151 GATCATGATGTACTGATAGTGAAGTTCGATATTAGCCATATTGACTGGAGATCATCTGGCTATACTAGGCGTGGAGTTAC GTCGTGTGTTACGATCTGGCGCTATCACTGTCAGCTGACTACTGATCGACACGATCAGCTGCTAGTACGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590018: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900182956642AA864163SMTBSOA000074SKSchistosoma Lambda Zap II


Date: 2:44:31 on Thu 23 Nov 117.