EST 1590019 is a singleton


Sequence

>1590019 (1 EST) Length=183 CGAGTTTTTTTTTTTTTAATCTTGCTCCTACCTGGTTTATAAAAGCCTTAATTGTTAAATTTCTGAAGACTTGAACTCCC AAGGTTTAATACCATCATGTTACTATTAAAGCTGACACTTGTTTTTTATCGATGTCTAATGATTGTACCAATAATTTTTG ATGATAAAGTGATCTCTTTGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1590019: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900192956643AA864164SMTBCEA000026SKSchistosoma Lambda Zap II cercariae


Date: 18:7:15 on Fri 17 Nov 117.