EST 1590021 is a singleton


Sequence

>1590021 (1 EST) Length=99 CATTTGTTTAATTATTTATTTAAATAAATCAACAGTGAATAACTTTCTGATATGGAAATATTTTTAAATATATACTATAC TACTATATAGGGGTACTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1590021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900212956645AA864166SMTBCEA000029SKSchistosoma Lambda Zap II cercariae


Date: 16:23:48 on Sun 19 Nov 117.