EST 1590022 is a singleton


Sequence

>1590022 (1 EST) Length=175 GGCACGAGAAAAACCCAATGTTACGGTTTTATTTGCTCTTGGTCCTATATAATGTCAAAGCTGCCAGTTTTTGCTAAAAC GTTAGCTGATATGGGACACAAGCGAGTTAGAAAAAACCCTCGCATTTATCCAAAAGCAAAAGGAAAGTTTCTCAAGTAGC ACACCTACCCAGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590022: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900222956646AA864167SMTBCEA000030SKSchistosoma Lambda Zap II cercariae


Date: 8:25:28 on Thu 23 Nov 117.