EST 1590023 is a singleton


Sequence

>1590023 (1 EST) Length=184 GGCACGAGACGAAGTTGAACTGGAAAATAGTTTTCGAGATTTATCTGTTCTCATCTAATTTTCTAGATAATTGACATAAA TTATCTAATAACAGCATCATTTTTATTTGTTTAAATAACTGAACATGTTTCTATTTTTTTGTACGTTTGTTGATATTTCT CCCATTTTCTCTGACTCACCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1590023: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900232956647AA864168SMTBCEA000031SKSchistosoma Lambda Zap II cercariae


Date: 4:28:27 on Thu 23 Nov 117.