EST 1590027 is a singleton


Sequence

>1590027 (1 EST) Length=151 TTGGGCGACGGAGCTTCGTACGTATCGGGGTTAGTCTCGGAACTAGTTATTTATCGAGTTAGGAAGAAAGTAAAGGCCCT TTGAAATGTCGTTGTTCTAGATGTATATTCTTTTAAGGTGCACGATGGATCGATTAGTCAATATGATATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1590027: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15900272956651AA864172SMTBCEA000035SKSchistosoma Lambda Zap II cercariae


Date: 1:4:25 on Tue 21 Nov 117.