EST 1592677 is a singleton


Sequence

>1592677 (1 EST) Length=443 TCAGAATGCCAAAACCAGCACCTCGTTTTGCCATGGGGCATATACTTCCCCGTCGCACCAATGTGGGGTCTCAGTTTTTG TACACACAGAAACACGGAGCTCGTAATGTTTGGTACAAGAAGCAGTACTTTTCTATTCGACCTTTTGCCATTCAAAGACA TAGAGGTACAACTCCACGCATCTTGCTTGACCGTAGCCTATGGAAATCGGTTTGGCTTACCAAAGTAAACCTTCCAGATG TCAATCGGTGGGAACGTGTTGTGAACAGTCAGCGTATCACTGAAGATCGATACGCCCTGGTCGAAGAAGAAGGTGTAATG CATAAGGTAAACTGGGGGCTTTATTGTGAACGGTTAGAAACTGAGTTAAAAGCTTCTCTGGAGCGATTACCACAGTACAC ACTTCTGATGAAGGCGGTTCCTTCAAGCTGGAAAAAACTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592677: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926772961947AA866502TENU0074T.cruzi epimastigote normalized cDNA Library


Date: 18:20:6 on Fri 17 Nov 117.